Browse wiki
| Sequence 1154(siSRP72b) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Signal recognition particle 72kDa Ensembl: ENSG00000174780 UniGene: Hs.237825 EntrezGene: 6731 Ensembl Chr4: 57028519 - 57064603 Strand: 1 GO terms: 0000786 0003677 0004871 0005488 0005634 0006334 0006468 0006614 0007165 0008312 0016301 0048500 |
| Design | SiRNA + |
| Name | siSRP72b + |
| Sequence | siRNA sense (21b) GGAGCTTTATGGACAAGTGTT / siRNA antisense (21b) CACTTGTCCATAAAGCTCCTT |
| Target | SRP72 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:09 + |
| hide properties that link here |
| No properties link to this page. |
