Sequence 1173(siSTAT1.2)

Sequence siSTAT1.2
Target	STAT1 (Homo sapiens)
Description	Signal transducer and activator of transcription 1, 91kDa Ensembl: ENSG00000115415 UniGene: Hs.642990 EntrezGene: 6772 Ensembl Chr2: 191542121 - 191587181 Strand: -1 GO terms: 0000074 0003700 0004871 0005062 0005509 0005515 0005634 0005737 0006350 0006355 0006366 0006919 0007165 0007242 0007249 0007260 0007262 0019221 0031663 0032496 0043330
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GCTTGACGTAGGAACGGTATT / siRNA antisense (21b) TACCGTTCCTACGTCAAGCAG
Application	gene silencing
Name	siSTAT1.2

References

Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Type I MGCA is a rare autosomal recessive disorder of leucine catabolism. The metabolic landmark is urinary excretion of 3-methylglutaconic acid (3-MGA) and its derivatives 3-methylglutaric acid (3-MG) and 3-hydroxyisovaleric acid (3-HIVA). Two main presentations have been described: 1 with onset in childhood associated with the nonspecific finding of psychomotor retardation, and the other with onset in adulthood of a progressive neurodegenerative disorder characterized by ataxia, spasticity, and sometimes dementia; these patients develop white matter lesions in the brain. However, some asymptomatic pediatric patients have been identified by newborn screening and show no developmental abnormalities when reexamined later in childhood (summary by Wortmann et al., 2010). Clinical Features. Greter et al. (1978) described brother and sister with choreoathetosis, spastic paraparesis, dementia, optic atrophy, and, in the urine, increased amounts of 3-methylglutaric and 3-methylglutaconic acids. The excretion was increased by leucine loading. 3-Methylglutaconic acid is known to be an intermediate in the catabolism of leucine. 3-Methylglutaconyl-CoA hydratase was postulated to be the deficient enzyme.

Robinson et al. (1976) gave a brief report of a case of 3-methylglutaconic aciduria. The clinical picture was somewhat different and the amounts of the 2 organic acids in the urine were about 5 times greater. The hydratase mentioned above was about 30% of normal in skeletal muscle. The authors were not convinced that the primary enzyme defect was in 3-methylglutaconyl-CoA hydratase. In fibroblasts from 2 brothers with 3-methylglutaconic aciduria reported by Duran et al. (1982), Narisawa et al. (1986) demonstrated deficiency (2 to 3% of normal) of 3-methylglutaconyl-CoA hydratase (EC 4.2.1.18). The phenotype in these brothers was different from that in the cases reported by Greter et al. (1978) and others, with a progressive degenerative neurologic disorder and lesser amounts of 3-methylglutaconic acid in the urine. In patients of the latter type, Narisawa et al. (1986) found normal activity of 3-MG-CoA-hydratase. In the sibs with deficiency, the clinical picture was similar. Both had retardation of speech development and in 1 this was the only abnormality. Motor development was also delayed in the older brother, who walked first at 2 years of age and had a short attention span. He had had an unexplained episode of unconsciousness lasting nearly a day. He responded to an 18-hour fast with symptomatic hypoglycemia and metabolic acidosis. Fasting did not produce hypoglycemia in the younger brother. Fibroblasts of the parents, who were not known to be related, were not available for study. Fibroblasts from patients with the neurologic degenerative form of 3-methylglutaconic aciduria had normal levels of the enzyme 3-MG-CoA-hydratase. Defects in all 8 enzymes involved in leucine degradation have been reported; see Figure 1 of Narisawa et al. (1986).

Gibson et al. (1991) emphasized phenotypic heterogeneity of this metabolic disorder.

Zeharia et al. (1992) described a seemingly 'new' variant in 2 sibs with normal enzyme activity who had choreoathetoid movements, optic atrophy, and mild developmental delay. The boy demonstrated developmental improvement in his second year of life and his sister developed well, with normal school performance.