Browse wiki
Sequence 1173(siSTAT1.2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Signal transducer and activator of transcr … Signal transducer and activator of transcription 1, 91kDa Ensembl: ENSG00000115415 UniGene: Hs.642990 EntrezGene: 6772 Ensembl Chr2: 191542121 - 191587181 Strand: -1 GO terms: 0000074 0003700 0004871 0005062 0005509 0005515 0005634 0005737 0006350 0006355 0006366 0006919 0007165 0007242 0007249 0007260 0007262 0019221 0031663 0032496 004333060 0007262 0019221 0031663 0032496 0043330 |
Design | SiRNA + |
Name | siSTAT1.2 + |
Sequence | siRNA sense (21b) GCTTGACGTAGGAACGGTATT / siRNA antisense (21b) TACCGTTCCTACGTCAAGCAG |
Target | STAT1 (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:15 + |
hide properties that link here |
No properties link to this page. |