Sequence 1186(SytI-3 , SytI3)
From Wikisequences
Sequence SytI-3 , SytI3 | |
---|---|
Target | Syt1 ( Mus musculus ) |
Description | Synaptotagmin I
Ensembl: ENSMUSG00000035864 UniGene: Mm.289702 EntrezGene: 20979 Ensembl Chr10: 107934706 - 108448031 Strand: -1 GO terms: 0005215 0005509 0005515 0005516 0005543 0005544 0005737 0005886 0006810 0007269 0008021 0016020 0016021 0030054 0030141 0030672 0031410 0042734 0042802 0043005 0045202 0050750 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) GGAAGAGGAGAAACTGGGATTCAAGAGATCCCAGTTTCTCCTCTTCCTT |
Application | gene silencing |
Name | SytI-3 , SytI3 |
References
RNA interference-mediated silencing of synaptotagmin IX, but not synaptotagmin I, inhibits dense-core vesicle exocytosis in PC12 cells.Fukuda M.Biochem J. 2004 Jun 15;380(Pt 3) :875-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478