Browse wiki
Sequence 1186(SytI-3 , SytI3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Synaptotagmin I Ensembl: ENSMUSG000000358 … Synaptotagmin I Ensembl: ENSMUSG00000035864 UniGene: Mm.289702 EntrezGene: 20979 Ensembl Chr10: 107934706 - 108448031 Strand: -1 GO terms: 0005215 0005509 0005515 0005516 0005543 0005544 0005737 0005886 0006810 0007269 0008021 0016020 0016021 0030054 0030141 0030672 0031410 0042734 0042802 0043005 0045202 005075010 0042734 0042802 0043005 0045202 0050750 |
Design | ShRNA + |
Name | SytI-3 , SytI3 + |
Sequence | (49b) GGAAGAGGAGAAACTGGGATTCAAGAGATCCCAGTTTCTCCTCTTCCTT |
Target | Syt1 ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:03 + |
hide properties that link here |
No properties link to this page. |