Sequence 1227(M VCAM-1)
From Wikisequences
| Sequence M VCAM-1 | |
|---|---|
| Target | Vcam1 ( Mus musculus ) |
| Description | Vascular cell adhesion molecule 1
Ensembl: ENSMUSG00000027962 UniGene: Mm.76649 EntrezGene: 22329 Ensembl Chr3: 115812940 - 115832606 Strand: -1 GO terms: 0005021 0005515 0005524 0005615 0006468 0007155 0016020 0016021 0016337 0048503 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (22b) CTAATTCATGGTAGAATGGCTA / Reverse PCR primer (22b) TGAAGTCGCATTTAAATCAGGT |
| Application | gene expression |
| Name | M VCAM-1 |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
