Browse wiki
Sequence 1227(M VCAM-1) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Vascular cell adhesion molecule 1 Ensembl: ENSMUSG00000027962 UniGene: Mm.76649 EntrezGene: 22329 Ensembl Chr3: 115812940 - 115832606 Strand: -1 GO terms: 0005021 0005515 0005524 0005615 0006468 0007155 0016020 0016021 0016337 0048503 |
Design | Primer set + |
Name | M VCAM-1 + |
Sequence | Forward PCR primer (22b) CTAATTCATGGTAGAATGGCTA / Reverse PCR primer (22b) TGAAGTCGCATTTAAATCAGGT |
Target | Vcam1 ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:21 + |
hide properties that link here |
No properties link to this page. |