Sequence 191 (ApoAI)

Sequence ApoAI
Target	APOA1 ( Homo sapiens )
Description	Apolipoprotein A1 Ensembl: ENSG00000118137 UniGene: Hs.633003 EntrezGene: 335 Ensembl Chr22: 13712 - 15105 Strand: 1
Design	primer set
Chemistry	DNA
Sequence	Forward PCR primer (19b) TGTGTCCCAGTTTGAAGGC / Reverse PCR primer (22b) CTCCTTTTCCAGGTTATCCCAG
Application	gene expression
Name	ApoAI

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background