Browse wiki
| Sequence 191 (ApoAI) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Apolipoprotein A1 Ensembl: ENSG00000118137 UniGene: Hs.633003 EntrezGene: 335 Ensembl Chr22: 13712 - 15105 Strand: 1 |
| Design | Primer set + |
| Name | ApoAI + |
| Sequence | Forward PCR primer (19b) TGTGTCCCAGTTTGAAGGC / Reverse PCR primer (22b) CTCCTTTTCCAGGTTATCCCAG |
| Target | APOA1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:03 + |
| hide properties that link here |
| No properties link to this page. |
