Sequence 21 (sll0629)

From Wikisequences
Jump to: navigation, search
Sequence sll0629
Target 6803s04 ( Synechocystis sp. PCC 6803 )
Description
Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) TCCCACCACCGCTGGTT / Reverse PCR primer (24b) CAAACACATTACAAAGGCACATGA
Application gene expression
Name sll0629

References

Integrated OMICS guided engineering of biofuel butanol-tolerance in photosynthetic Synechocystis sp. PCC 6803.Zhu H, Ren X, Wang J, Song Z, Shi M, Qiao J, Tian X, Liu J, Chen L, Zhang W.Biotechnol Biofuels. 2013 Jul 25;6(1) :106. doi: 10.1186/1754-6834-6-106.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders