Browse wiki

Jump to: navigation, search
Sequence 21 (sll0629)
Application Gene expression +
Chemistry DNA +
Design Primer set +
Name sll0629  +
Sequence Forward PCR primer (20b) TCCCACCACCGCTGGTT / Reverse PCR primer (24b) CAAACACATTACAAAGGCACATGA
Target 6803s04 ( Synechocystis sp. PCC 6803 ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:30  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders