Sequence 23 (sll1734)
From Wikisequences
| Sequence sll1734 | |
|---|---|
| Target | 6803s06 ( Synechocystis sp. PCC 6803 ) |
| Description | |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) TGGCATGACCGCATCAAC / Reverse PCR primer (20b) CATAGCATTGCTTGCATGCA |
| Application | gene expression |
| Name | sll1734 |
References
Integrated OMICS guided engineering of biofuel butanol-tolerance in photosynthetic Synechocystis sp. PCC 6803.Zhu H, Ren X, Wang J, Song Z, Shi M, Qiao J, Tian X, Liu J, Chen L, Zhang W.Biotechnol Biofuels. 2013 Jul 25;6(1) :106. doi: 10.1186/1754-6834-6-106.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
