Browse wiki

Jump to: navigation, search
Sequence 23 (sll1734)
Application Gene expression +
Chemistry DNA +
Design Primer set +
Name sll1734  +
Sequence Forward PCR primer (20b) TGGCATGACCGCATCAAC / Reverse PCR primer (20b) CATAGCATTGCTTGCATGCA
Target 6803s06 ( Synechocystis sp. PCC 6803 ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:52  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders