Sequence 30 (HPRT1)
From Wikisequences
| Sequence HPRT1 | |
|---|---|
| Target | ABCA1 ( Homo sapiens ) |
| Description | ATP-binding cassette, sub-family A ( ABC1 ), member 1
Ensembl: ENSG00000129673 UniGene: Hs.429294 EntrezGene: 19 Ensembl Chr17: 71961028 - 71977793 Strand: 1 GO terms: 0004059 0007623 0008080 0008152 0008415 0016740 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (21b) TGACACTGGCAAAACAATGCA / Reverse PCR primer (21b) GGTCCTTTTCACCAGCAAGCT |
| Application | gene expression |
| Name | HPRT1 |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
