Browse wiki
Sequence 30 (HPRT1) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | ATP-binding cassette, sub-family A ( ABC1 ), member 1 Ensembl: ENSG00000129673 UniGene: Hs.429294 EntrezGene: 19 Ensembl Chr17: 71961028 - 71977793 Strand: 1 GO terms: 0004059 0007623 0008080 0008152 0008415 0016740 |
Design | Primer set + |
Name | HPRT1 + |
Sequence | Forward PCR primer (21b) TGACACTGGCAAAACAATGCA / Reverse PCR primer (21b) GGTCCTTTTCACCAGCAAGCT |
Target | ABCA1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
hide properties that link here |
No properties link to this page. |