Sequence 337 (CD36)
From Wikisequences
| Sequence CD36 | |
|---|---|
| Target | CD36 ( Homo sapiens ) |
| Description | CD36 molecule ( thrombospondin receptor )
Ensembl: ENSG00000135218 UniGene: Hs.120949 EntrezGene: 948 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) GAGAACTGTTATGGGGCTAT / Reverse PCR primer (20b) TTCAACTGGAGAGGCAAAGG |
| Application | gene expression |
| Name | CD36 |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
