Browse wiki
Sequence 337 (CD36) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | CD36 molecule ( thrombospondin receptor ) Ensembl: ENSG00000135218 UniGene: Hs.120949 EntrezGene: 948 |
Design | Primer set + |
Name | CD36 + |
Sequence | Forward PCR primer (20b) GAGAACTGTTATGGGGCTAT / Reverse PCR primer (20b) TTCAACTGGAGAGGCAAAGG |
Target | CD36 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:43 + |
hide properties that link here |
No properties link to this page. |