Browse wiki

Jump to: navigation, search
Sequence 337 (CD36)
Application Gene expression +
Chemistry DNA +
Description CD36 molecule ( thrombospondin receptor ) Ensembl: ENSG00000135218 UniGene: Hs.120949 EntrezGene: 948
Design Primer set +
Name CD36  +
Sequence Forward PCR primer (20b) GAGAACTGTTATGGGGCTAT / Reverse PCR primer (20b) TTCAACTGGAGAGGCAAAGG
Target CD36 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:43  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders