Sequence 376 (Cideb)
From Wikisequences
| Sequence Cideb | |
|---|---|
| Target | CIDEB ( Homo sapiens ) |
| Description | Cell death-inducing DFFA-like effector b
Ensembl: ENSG00000136305 UniGene: Hs.696081 EntrezGene: 27141 Ensembl Chr14: 23844241 - 23850468 Strand: -1 GO terms: 0005515 0005622 0005829 0006915 0006917 0008630 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (19b) TGATGGTGTTGCAGTCTGG / Reverse PCR primer (21b) AAAGAGGTCTCGAGGGTTTTG |
| Application | gene expression |
| Name | Cideb |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
