Browse wiki
| Sequence 376 (Cideb) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Cell death-inducing DFFA-like effector b Ensembl: ENSG00000136305 UniGene: Hs.696081 EntrezGene: 27141 Ensembl Chr14: 23844241 - 23850468 Strand: -1 GO terms: 0005515 0005622 0005829 0006915 0006917 0008630 |
| Design | Primer set + |
| Name | Cideb + |
| Sequence | Forward PCR primer (19b) TGATGGTGTTGCAGTCTGG / Reverse PCR primer (21b) AAAGAGGTCTCGAGGGTTTTG |
| Target | CIDEB ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:38 + |
| hide properties that link here |
| No properties link to this page. |
