Sequence 377 (Cidec)
From Wikisequences
Sequence Cidec | |
---|---|
Target | CIDEC ( Homo sapiens ) |
Description | Cell death-inducing DFFA-like effector c
Ensembl: ENSG00000187288 UniGene: Hs.567562 EntrezGene: 63924 Ensembl Chr3: 9883399 - 9895740 Strand: -1 GO terms: 0003674 0004867 0005515 0005622 0005737 0005829 0006915 0006917 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (24b) TTGATGTGGCCCGTGTAACGTTTG / Reverse PCR primer (24b) AAGCTTCCTTCATGATGCGCTTGG |
Application | gene expression |
Name | Cidec |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478