Browse wiki
| Sequence 377 (Cidec) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Cell death-inducing DFFA-like effector c Ensembl: ENSG00000187288 UniGene: Hs.567562 EntrezGene: 63924 Ensembl Chr3: 9883399 - 9895740 Strand: -1 GO terms: 0003674 0004867 0005515 0005622 0005737 0005829 0006915 0006917 |
| Design | Primer set + |
| Name | Cidec + |
| Sequence | Forward PCR primer (24b) TTGATGTGGCCCGTGTAACGTTTG / Reverse PCR primer (24b) AAGCTTCCTTCATGATGCGCTTGG |
| Target | CIDEC ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:41 + |
| hide properties that link here |
| No properties link to this page. |
