Sequence 400 (si 031)
From Wikisequences
Sequence si_031 | |
---|---|
Target | CSNK2A1 ( Homo sapiens ) |
Description | Casein kinase 2, alpha 1 polypeptide
Ensembl: ENSG00000101266 UniGene: Hs.701971 EntrezGene: 1457 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CCAGCTGGTTCGAAAATTAGG / siRNA antisense (21b) TAATTTTCGAACCAGCTGGTA |
Application | gene silencing |
Name | si_031 |
References
DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478