Browse wiki
Sequence 400 (si 031) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Casein kinase 2, alpha 1 polypeptide Ensembl: ENSG00000101266 UniGene: Hs.701971 EntrezGene: 1457 |
Design | SiRNA + |
Name | si_031 + |
Sequence | siRNA sense (21b) CCAGCTGGTTCGAAAATTAGG / siRNA antisense (21b) TAATTTTCGAACCAGCTGGTA |
Target | CSNK2A1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:31 + |
hide properties that link here |
No properties link to this page. |