Sequence 619 (RelA)
| Sequence RelA | |
|---|---|
| Target | HLA-A ( Homo sapiens ) |
| Description | Major histocompatibility complex, class I, A
Ensembl: ENSG00000206503 UniGene: Hs.652059 , Hs.661049 EntrezGene: 4931 Ensembl Chr6: 30017016 - 30021640 Strand: 1 GO terms: 0002474 0005515 0005887 0006955 0016020 0016021 0019882 0032393 0042612 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) GCATCCACAGTTTCCAGAAC / Reverse PCR primer (20b) CACTGTCACCTGGAAGCAGA |
| Application | gene expression |
| Name | RelA |
References
Low immunogenicity of neural progenitor cells differentiated from induced pluripotent stem cells derived from less immunogenic somatic cells.Liu P, Chen S, Li X, Qin L, Huang K, Wang L, Huang W, Li S, Jia B, Zhong M, Pan G, Cai J, Pei D.PLoS One. 2013 Jul 26;8(7) :e69617. doi: 10.1371/journal.pone.0069617. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
