Browse wiki
Sequence 619 (RelA) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Major histocompatibility complex, class I, A Ensembl: ENSG00000206503 UniGene: Hs.652059 , Hs.661049 EntrezGene: 4931 Ensembl Chr6: 30017016 - 30021640 Strand: 1 GO terms: 0002474 0005515 0005887 0006955 0016020 0016021 0019882 0032393 0042612 |
Design | Primer set + |
Name | RelA + |
Sequence | Forward PCR primer (20b) GCATCCACAGTTTCCAGAAC / Reverse PCR primer (20b) CACTGTCACCTGGAAGCAGA |
Target | HLA-A ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:02 + |
hide properties that link here |
No properties link to this page. |