Sequence 623 (HLA-DQB)
From Wikisequences
Sequence HLA-DQB | |
---|---|
Target | HLA-DQB1 ( Homo sapiens ) |
Description | Major histocompatibility complex, class II, DQ beta 1
Ensembl: ENSG00000133740 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (23b) GGAGACCTTCGGGTAGCAACTGT / Reverse PCR primer (25b) GAAGTAGCACATGCCCTTAAACTGG |
Application | gene expression |
Name | HLA-DQB |
References
Low immunogenicity of neural progenitor cells differentiated from induced pluripotent stem cells derived from less immunogenic somatic cells.Liu P, Chen S, Li X, Qin L, Huang K, Wang L, Huang W, Li S, Jia B, Zhong M, Pan G, Cai J, Pei D.PLoS One. 2013 Jul 26;8(7) :e69617. doi: 10.1371/journal.pone.0069617. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478