Browse wiki
Sequence 623 (HLA-DQB) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Major histocompatibility complex, class II, DQ beta 1 Ensembl: ENSG00000133740 |
Design | Primer set + |
Name | HLA-DQB + |
Sequence | Forward PCR primer (23b) GGAGACCTTCGGGTAGCAACTGT / Reverse PCR primer (25b) GAAGTAGCACATGCCCTTAAACTGG |
Target | HLA-DQB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:34 + |
hide properties that link here |
No properties link to this page. |