Sequence 692 (si 137)
From Wikisequences
Sequence si_137 | |
---|---|
Target | LIG1 ( Homo sapiens ) |
Description | Ligase I, DNA, ATP-dependent
Ensembl: ENSG00000144908 UniGene: Hs.1770 EntrezGene: 3978 Ensembl Chr3: 127305098 - 127382719 Strand: -1 GO terms: 0003824 0005737 0006412 0006730 0008152 0008168 0009058 0009258 0016155 0016491 0016742 0048037 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CCTGCGAATACAAATATGACG / siRNA antisense (21b) TCATATTTGTATTCGCAGGTG |
Application | gene silencing |
Name | si_137 |
References
DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478