Browse wiki
Sequence 692 (si 137) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Ligase I, DNA, ATP-dependent Ensembl: ENSG00000144908 UniGene: Hs.1770 EntrezGene: 3978 Ensembl Chr3: 127305098 - 127382719 Strand: -1 GO terms: 0003824 0005737 0006412 0006730 0008152 0008168 0009058 0009258 0016155 0016491 0016742 0048037 |
Design | SiRNA + |
Name | si_137 + |
Sequence | siRNA sense (21b) CCTGCGAATACAAATATGACG / siRNA antisense (21b) TCATATTTGTATTCGCAGGTG |
Target | LIG1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:39 + |
hide properties that link here |
No properties link to this page. |