Sequence 699 (LIMCH1)
From Wikisequences
| Sequence LIMCH1 | |
|---|---|
| Target | LIMCH1 ( Homo sapiens ) |
| Description | LIM and calponin homology domains 1
Ensembl: ENSG00000064042 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (21b) TCCAAGCAGTGAGAAGTCACC / Reverse PCR primer (20b) TCTCCTGGAGCAAACGTTCC |
| Application | gene expression |
| Name | LIMCH1 |
References
Long-term cultured mesenchymal stem cells frequently develop genomic mutations but do not undergo malignant transformation.Wang Y, Zhang Z, Chi Y, Zhang Q, Xu F, Yang Z, Meng L, Yang S, Yan S, Mao A, Zhang J, Yang Y, Wang S, Cui J, Liang L, Ji Y, Han ZB, Fang X, Han ZC.Cell Death Dis. 2013 Dec 5;4:e950. doi: 10.1038/cddis.2013.480.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
