Browse wiki
| Sequence 699 (LIMCH1) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | LIM and calponin homology domains 1 Ensembl: ENSG00000064042 |
| Design | Primer set + |
| Name | LIMCH1 + |
| Sequence | Forward PCR primer (21b) TCCAAGCAGTGAGAAGTCACC / Reverse PCR primer (20b) TCTCCTGGAGCAAACGTTCC |
| Target | LIMCH1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:28 + |
| hide properties that link here |
| No properties link to this page. |
