Sequence 730 (ISIS-399479 , ISIS 399479)
From Wikisequences
| Sequence ISIS-399479 , ISIS 399479 | |
|---|---|
| Target | Malat1 ( Mus musculus ) |
| Description | Metastasis associated lung adenocarcinoma transcript 1 ( non-coding RNA )
Ensembl: ENSMUSG00000092341 UniGene: Mm.298256 EntrezGene: 72289 |
| Design | MOE gapmer |
| Chemistry | moC*moG*moG*moT*moG*C*A*A*G*G*C*T*T*A*G*moG*moA*moA*moT*moT |
| Sequence | CGGTGCAAGGCTTAGGAATT |
| Application | gene silencing |
| Name | ISIS-399479 , ISIS 399479 |
References
Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
