Browse wiki
Sequence 730 (ISIS-399479 , ISIS 399479) |
Application | Gene silencing + |
---|---|
Chemistry | MoC*moG*moG*moT*moG*C*A*A*G*G*C*T*T*A*G*moG*moA*moA*moT*moT + |
Description | Metastasis associated lung adenocarcinoma transcript 1 ( non-coding RNA ) Ensembl: ENSMUSG00000092341 UniGene: Mm.298256 EntrezGene: 72289 |
Design | MOE gapmer + |
Name | ISIS-399479 , ISIS 399479 + |
Sequence | CGGTGCAAGGCTTAGGAATT |
Target | Malat1 ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:37 + |
hide properties that link here |
No properties link to this page. |