Sequence 888 (H 28S)

From Wikisequences
Jump to: navigation, search
Sequence H 28S
Target MRPS28 ( Homo sapiens )
Description Mitochondrial ribosomal protein S28

Ensembl: ENSG00000127463

Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) CAGTTCTCTTGGGAATCCAG / Reverse PCR primer (22b) TTCAGCAAAGGAGTCAATCCAC
Application gene expression
Name H 28S

References

Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders