Browse wiki
| Sequence 888 (H 28S) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Mitochondrial ribosomal protein S28 Ensembl: ENSG00000127463 |
| Design | Primer set + |
| Name | H 28S + |
| Sequence | Forward PCR primer (20b) CAGTTCTCTTGGGAATCCAG / Reverse PCR primer (22b) TTCAGCAAAGGAGTCAATCCAC |
| Target | MRPS28 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:39 + |
| hide properties that link here |
| No properties link to this page. |
