Sequence 915 (NCSTN)
Sequence NCSTN | |
---|---|
Target | NCSTN ( Homo sapiens ) |
Description | Nicastrin
Ensembl: ENSG00000162736 UniGene: Hs.517249 EntrezGene: 23385 Ensembl Chr1: 158579678 - 158595366 Strand: 1 GO terms: 0003735 0005515 0005622 0005624 0005783 0005794 0005840 0005887 0006412 0006509 0007220 0016020 0016021 0016485 0042987 0043085 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGGCAAGTTTCCCGTGCAGTT / siRNA antisense (21b) CTGCACGGGAAACTTGCCCTT |
Application | gene silencing |
Name | NCSTN |
References
Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation.Xie Z, Romano DM, Kovacs DM, Tanzi RE.J Biol Chem. 2004 Aug 13;279(33) :34130-7. Epub 2004 Jun 7.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. Nicastrin is a type-1 transmembrane glycoprotein that forms high molecular mass gamma-secretase complexes with presenilin-1 (PS1; see 104311) and presenilin-2 (PS2; 600759) that are necessary for the endoproteolysis of several type-1 transmembrane proteins, including beta-amyloid precursor protein (beta-APP; 104760) and Notch receptor (see 190198).Gene Function. Yu et al. (2000) observed that suppression of nicastrin expression in C. elegans embryos induced a subset of notch/glp-1 phenotypes similar to those induced by simultaneous null mutations in both presenilin homologs of C. elegans. Nicastrin also bound C-terminal derivatives of beta-APP, and modulated the production of the amyloid-beta peptide from these derivatives.
Yu et al. (2000) generated missense mutations in a conserved hydrophilic domain of nicastrin. Missense mutation of the conserved DYIGS motif to AAIGS (residues 336 to 340) increased amyloid-beta-42 and amyloid-beta-40 peptide secretion. Deletions in this domain inhibited amyloid-beta production.
In a review article, Kopan and Goate (2002) discussed the evidence for various proposed roles for nicastrin, including a role as regulator of Notch signaling, a component of gamma-secretase, and a regulator of presenilin localization and stabilization. The authors included a summary of the identification of nicastrin and a brief discussion of nicastrin as a genetic risk factor for Alzheimer disease.
Goutte et al. (2002) determined that the cell surface localization of the Notch component Aph2, the C. elegans homolog of nicastrin, requires Aph1 (see APH1A; 607629) and presenilins.
Using coimmunoprecipitation and nickel affinity pull-down approaches, Lee et al. (2002) showed that nicastrin and presenilin heterodimers physically associated with APH1A and APH1B (607630) in vivo.