Browse wiki
Sequence 915 (NCSTN) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Nicastrin Ensembl: ENSG00000162736 UniGen … Nicastrin Ensembl: ENSG00000162736 UniGene: Hs.517249 EntrezGene: 23385 Ensembl Chr1: 158579678 - 158595366 Strand: 1 GO terms: 0003735 0005515 0005622 0005624 0005783 0005794 0005840 0005887 0006412 0006509 0007220 0016020 0016021 0016485 0042987 004308520 0016020 0016021 0016485 0042987 0043085 |
Design | SiRNA + |
Name | NCSTN + |
Sequence | siRNA sense (21b) GGGCAAGTTTCCCGTGCAGTT / siRNA antisense (21b) CTGCACGGGAAACTTGCCCTT |
Target | NCSTN ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
hide properties that link here |
No properties link to this page. |