Browse wiki
Sequence 1019(hcPLA2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Phospholipase A2, group IVA ( cytosolic, c … Phospholipase A2, group IVA ( cytosolic, calcium-dependent ) Ensembl: ENSG00000116711 UniGene: Hs.497200 EntrezGene: 5321 Ensembl Chr1: 185064655 - 185224726 Strand: 1 GO terms: 0000287 0004289 0004427 0004620 0004622 0004623 0005509 0005737 0005829 0006508 0006663 0006690 0006796 0009395 0016021 0016042 0016787 003141096 0009395 0016021 0016042 0016787 0031410 |
Design | SiRNA + |
Name | hcPLA2 + |
Sequence | siRNA sense (21b) GTTTACGGTAGTGGTGTTATT / siRNA antisense (21b) TAACACCACTACCGTAAACTT |
Target | PLA2G4A ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
hide properties that link here |
No properties link to this page. |