Browse wiki
Sequence 1045(PSEN1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Presenilin 1 ( Alzheimer disease 3 ) Ense … Presenilin 1 ( Alzheimer disease 3 ) Ensembl: ENSG00000080815 UniGene: Hs.592324 EntrezGene: 5663 Ensembl Chr14: 72672908 - 72756862 Strand: 1 GO terms: 0000776 0001568 0001708 0001756 0001764 0004175 0005515 0005622 0005624 0005634 0005639 0005739 0005783 0005794 0005887 0006509 0006874 0006915 0006916 0007001 0007059 0007155 000722015 0006916 0007001 0007059 0007155 0007220 |
Design | SiRNA + |
Name | PSEN1 + |
Sequence | siRNA sense (21b) GGTCCACTTCGTATGCTGGTT / siRNA antisense (21b) CCAGCATACGAAGTGGACCTT |
Target | PSEN1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:47 + |
hide properties that link here |
No properties link to this page. |