Browse wiki
| Sequence 1147(siSOS1.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Son of sevenless homolog 1 (Drosophila) E … Son of sevenless homolog 1 (Drosophila) Ensembl: ENSG00000115904 UniGene: Hs.654397 EntrezGene: 6654 Ensembl Chr2: 39062206 - 39201095 Strand: -1 GO terms: 0000786 0003677 0005085 0005089 0005100 0005515 0005622 0005634 0005886 0006334 0007001 0007165 0007264 0007265 0014069 0017124 0035023 0043025 0045742 0048011 005105624 0035023 0043025 0045742 0048011 0051056 |
| Design | SiRNA + |
| Name | siSOS1.1 + |
| Sequence | siRNA sense (21b) GGTTGAATCCATCACTAAATT / siRNA antisense (21b) TTTAGTGATGGATTCAACCCA |
| Target | SOS1 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
