Browse wiki
| Sequence 1174(siSTAT3.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Signal transducer and activator of transcr … Signal transducer and activator of transcription 3 (acute-phase response factor) Ensembl: ENSG00000168610 UniGene: Hs.463059 EntrezGene: 6774 Ensembl Chr17: 37718869 - 37794039 Strand: -1 GO terms: 0000122 0003700 0004871 0005062 0005509 0005634 0005737 0006355 0006928 0006953 0007165 0007242 0007259 0007399 0008134 001922165 0007242 0007259 0007399 0008134 0019221 |
| Design | SiRNA + |
| Name | siSTAT3.2 + |
| Sequence | siRNA sense (21b) CGTCATTAGCAGAATCTCATT / siRNA antisense (21b) TGAGATTCTGCTAATGACGTT |
| Target | STAT3 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:21 + |
| hide properties that link here |
| No properties link to this page. |
