Browse wiki

Jump to: navigation, search
Sequence 1178(b3a2 1)
Application Gene silencing +
Chemistry RNA +
Description SGT1, suppressor of G2 allele of SKP1 ( S.SGT1, suppressor of G2 allele of SKP1 ( S. cerevisiae ) Ensembl: ENSG00000074803 UniGene: Hs.281902 EntrezGene: 10910 Ensembl Chr15: 46285791 - 46383567 Strand: 1 GO terms: 0004413 0005215 0005515 0005524 0005624 0005886 0006566 0006810 0006811 0006813 0006814 0006821 0006835 0008152 0008511 0015293 0015377 0016020 0016021 0016740 0017153 0030955 003140220 0016021 0016740 0017153 0030955 0031402
Design ShRNA +
Name b3a2_1  +
Sequence (64b) GATCCCGCAGAGTTCAAAAGCCCTTTTCAAGAGAAAGGGCTTTTGAACTCTGCTTTTTTGGAAG
Target SUGT1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:06  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders