Browse wiki
| Sequence 1193(H/M A20) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Tumor necrosis factor, alpha-induced prote … Tumor necrosis factor, alpha-induced protein 3 Ensembl: ENSG00000119684 UniGene: Hs.591338 EntrezGene: 7128 Ensembl Chr14: 74550220 - 74587988 Strand: -1 GO terms: 0000793 0000795 0003682 0003696 0005515 0005524 0005634 0005712 0006298 0006974 0007130 0007131 0007140 0007144 0008104 0019237 003098331 0007140 0007144 0008104 0019237 0030983 |
| Design | Primer set + |
| Name | H/M A20 + |
| Sequence | Forward PCR primer (23b) CCTCTTCTTCGCCTGCTTTGTCC / Reverse PCR primer (23b) CCCCGTCACCAAGCCGTTGTACC |
| Target | Tnfaip3 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
| hide properties that link here |
| No properties link to this page. |
