Browse wiki
| Sequence 1195(TNFR2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tumor necrosis factor receptor superfamily … Tumor necrosis factor receptor superfamily, member 1B Ensembl: ENSG00000028137 UniGene: Hs.256278 EntrezGene: 7133 Ensembl Chr1: 12149647 - 12191863 Strand: 1 GO terms: 0004872 0004888 0005031 0005515 0006915 0006954 0006955 0007165 0007166 0008219 0016020 0016021 0019221 0050728 005077919 0016020 0016021 0019221 0050728 0050779 |
| Design | SiRNA + |
| Name | TNFR2 + |
| Sequence | siRNA sense (21b) CAGAACCGCATCTGCACCTTT / siRNA antisense (21b) AGGTGCAGATGCGGTTCTGTT |
| Target | TNFRSF1B ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
| hide properties that link here |
| No properties link to this page. |
