Browse wiki
| Sequence 1204(P53BP1 2 , P53BP12) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tumor protein p53 binding protein 1 Ensem … Tumor protein p53 binding protein 1 Ensembl: ENSG00000067369 UniGene: Hs.440968 EntrezGene: 7158 Ensembl Chr15: 41486699 - 41590028 Strand: -1 GO terms: 0000776 0003676 0003677 0003684 0005515 0005622 0005634 0005654 0005657 0005737 0006281 0006350 0016563 004589357 0005737 0006281 0006350 0016563 0045893 |
| Design | SiRNA + |
| Name | P53BP1_2 , P53BP12 + |
| Sequence | siRNA sense (21b) GATACTCCTTGCCTGATAATT / siRNA antisense (21b) TTATCAGGCAAGGAGTATCTT |
| Target | TP53BP1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
| hide properties that link here |
| No properties link to this page. |
