Browse wiki
| Sequence 1205(p73) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tumor protein p73 Ensembl: ENSG00000078900 UniGene: Hs.697294 EntrezGene: 7161 Ensembl Chr1: 3558989 - 3639716 Strand: 1 GO terms: 0003677 0003700 0005515 0005634 0006298 0006350 0006355 0006915 0007049 0008270 0008630 0045786 0045893 0046872 |
| Design | ShRNA + |
| Name | p73 + |
| Sequence | (63b) GATCCCCGCCGGGGGAATAATGAGGTTTCAAGAGAACCTCATTATTCCCCCGGCTTTTGGAAA |
| Target | TP73 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:06 + |
| hide properties that link here |
| No properties link to this page. |
