Browse wiki
| Sequence 1207() |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tumor protein, translationally-controlled 1 Ensembl: ENSG00000133112 UniGene: Hs.374596 EntrezGene: 7178 Ensembl Chr13: 44809008 - 44813347 Strand: -1 GO terms: 0005509 0005515 0005615 0005737 0005771 0006816 0006874 0006916 0042981 0045298 |
| Design | SiRNA + |
| Sequence | siRNA sense (21b) GGTACCGAAAGCACAGTAATT / siRNA antisense (21b) TTACTGTGCTTTCGGTACCTT |
| Target | TPT1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
