Browse wiki
Sequence 1214(Tsg101) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Tumor susceptibility gene 101 Ensembl: EN … Tumor susceptibility gene 101 Ensembl: ENSG00000074319 UniGene: Hs.523512 EntrezGene: 7251 Ensembl Chr11: 18458438 - 18505065 Strand: -1 GO terms: 0001558 0003677 0003714 0005515 0005634 0005737 0006464 0006512 0007050 0008285 0015031 0016020 0019787 0030216 004589285 0015031 0016020 0019787 0030216 0045892 |
Design | SiRNA + |
Name | Tsg101 + |
Sequence | siRNA sense (21b) CCTCCAGTCTTCTCTCGTCTT / siRNA antisense (21b) GACGAGAGAAGACTGGAGGTT |
Target | TSG101 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:22 + |
hide properties that link here |
No properties link to this page. |