Browse wiki
| Sequence 1221(ICBP90-2 , ICBP902) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Ubiquitin-like, containing PHD and RING fi … Ubiquitin-like, containing PHD and RING finger domains, 1 Ensembl: ENSG00000034063 UniGene: Hs.108106 EntrezGene: 29128 Ensembl Chr19: 4860510 - 4913162 Strand: 1 GO terms: 0003700 0003702 0005515 0005634 0006281 0006350 0006357 0006464 0006512 0007049 0008270 0008283 0016874 004687212 0007049 0008270 0008283 0016874 0046872 |
| Design | SiRNA + |
| Name | ICBP90-2 , ICBP902 + |
| Sequence | siRNA sense (21b) TGAGTACGTCGATGCTCGGTT / siRNA antisense (21b) CCGAGCATCGACGTACTCATT |
| Target | UHRF1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
| hide properties that link here |
| No properties link to this page. |
