Browse wiki
| Sequence 1223(UPF1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | UPF1 regulator of nonsense transcripts hom … UPF1 regulator of nonsense transcripts homolog ( yeast ) Ensembl: ENSG00000005007 UniGene: Hs.515266 EntrezGene: 5976 Ensembl Chr19: 18803744 - 18840038 Strand: 1 GO terms: 0000166 0000184 0000785 0003677 0003682 0003723 0004004 0004386 0005515 0005524 0005737 0006260 0006281 0006396 0006406 0006449 0007049 0008270 0016787 0017111 004687249 0007049 0008270 0016787 0017111 0046872 |
| Design | SiRNA + |
| Name | UPF1 + |
| Sequence | siRNA sense (21b) AAGATGCAGTTCCGCTCCATT / siRNA antisense (21b) TGGAGCGGAACTGCATCTTTT |
| Target | UPF1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
| hide properties that link here |
| No properties link to this page. |
